Gel Electrophoresis Worksheet with Answers (Grade 11 Biology)

This free gel electrophoresis worksheet turns students into forensic scientists. After learning the key biotechnology vocabulary, they explain how gels separate DNA, use EcoRI to cut a real DNA sequence into fragments, and weigh the benefits and concerns of genetically modified crops.

They then read a crime scene DNA fingerprinting gel and a paternity test gel, calculate how PCR multiplies DNA, and put the steps for making human insulin in bacteria in order.

• Grade 11 Biology
• 24 marks
• 40–50 minutes
• Full answer key

What's in This Gel Electrophoresis Worksheet

Part	Skill practised	Marks
A	Biotechnology vocabulary	3
B	How gel electrophoresis works	4
C	Cutting DNA with EcoRI	4
D	Biotechnology and society	2
E	DNA fingerprinting gel	3
F	Paternity testing gel	2
G	PCR and recombinant DNA	4
H	Spot the mistake	2

It supports the Ontario Grade 11 biology curriculum expectations in the Genetic Processes unit, where students explore biotechnology and its effects on society.

Term	Meaning
Restriction enzyme	Cuts DNA at a specific base sequence
DNA ligase	Joins pieces of DNA together
Plasmid	A small circle of DNA found in bacteria
PCR	A method that makes millions of copies of a DNA segment
DNA ladder	DNA fragments of known sizes run beside samples to measure them
Recombinant DNA	DNA made by joining pieces from two different sources

How Gel Electrophoresis Works

DNA samples are loaded into wells at one end of a slab of agarose gel, and an electric current is switched on. Because DNA is negatively charged, it moves toward the positive end. The gel acts like a sieve: small fragments travel farthest, while large fragments stay near the wells. A DNA ladder of known sizes runs in the first lane so the size of every other band can be estimated, and a stain makes the colourless DNA visible. Part B of the gel electrophoresis worksheet asks students to explain each of these ideas. For more detail, see gel electrophoresis on Wikipedia.

Cutting DNA with Restriction Enzymes

Restriction enzymes act like molecular scissors that cut only at one specific sequence. EcoRI recognizes GAATTC and cuts between the G and the A. Part C of the gel electrophoresis worksheet gives this 33-base strand:

5′ CCTAGAATTCGGATCCATTGCAGAATTCTAGTC 3′

It contains 2 EcoRI sites, so the enzyme makes 3 fragments of 5, 18, 10 base pairs. On a gel, the 5 bp fragment would travel farthest. EcoRI leaves short single-stranded sticky ends, which can pair with any other DNA cut by the same enzyme. That is the key to recombinant DNA.

Reading Fingerprinting and Paternity Gels

In a DNA fingerprinting gel, a suspect matches only if every band lines up with the crime scene sample. Here, Suspect 2 is the match, and the ladder shows that the middle crime scene band is about 3000 bp. In a paternity test, each of the child's bands must come from the mother or the father. The child's 6000 bp band matches the mother, so the 1500 bp band must come from the father. Man B has it, and Man A is excluded. These are the two most common gel types on any gel electrophoresis worksheet.

PCR and Recombinant DNA

PCR (polymerase chain reaction) copies a segment of DNA, doubling it every cycle. Starting with 10 molecules, 5 cycles give 10 × 2⁵ = 320 molecules, and a single molecule becomes about 1.07 × 10⁹ copies after 30 cycles. That is how forensic labs get enough DNA from a single hair.

Recombinant DNA technology puts a human gene into bacteria. The steps students order in Part G of the gel electrophoresis worksheet are:

1. Cut the human insulin gene out with a restriction enzyme
2. Cut a plasmid open with the same restriction enzyme
3. Join the insulin gene into the plasmid with DNA ligase
4. Insert the recombinant plasmid into bacteria
5. Bacteria multiply and produce human insulin

Most of the insulin people with diabetes use today is made this way. To review how a gene is read to build a protein like insulin, see the protein synthesis worksheet; DNA's structure is covered in the DNA replication worksheet.

Gel Electrophoresis Worksheet Practice Questions

These questions match the gel electrophoresis worksheet PDF, which has both gels, the DNA sequence and ruled answer space.

Part A – Biotechnology Vocabulary

1. Restriction enzyme
2. DNA ligase
3. Plasmid
4. PCR
5. DNA ladder
6. Recombinant DNA

Part B – How Gel Electrophoresis Works

7. Why does DNA move toward the positive (+) end of the gel?
8. Which DNA fragments travel farthest through the gel, and why?
9. What is the purpose of the DNA ladder?
10. Why must the DNA be stained before it can be seen?

Part C – Cutting DNA with EcoRI

11. How many EcoRI recognition sites are in the sequence?
12. How many fragments will EcoRI produce from this piece of DNA?
13. Give the length of each fragment in base pairs (bp).
14. EcoRI leaves “sticky ends.” Why are sticky ends useful in genetic engineering?

Part D – Biotechnology and Society

15. Genetically modified (GM) crops can be engineered to resist insects. Give one benefit and one concern about growing GM crops. (2 marks)

Part E – DNA Fingerprinting

16. Which suspect's DNA matches the crime scene sample?
17. Explain how you know.
18. Use the ladder to estimate the size of the middle crime scene band.

Part F – Paternity Testing

19. Which man could be the child's biological father?
20. Explain your answer, including why the other man is excluded.

Part G – PCR and Recombinant DNA

21. PCR doubles the amount of DNA in every cycle. Starting with 10 DNA molecules, how many are there after 5 cycles?
22. Starting with a single DNA molecule, how many copies are there after 30 cycles? Give your answer in scientific notation.
23. Put the steps for making human insulin in bacteria in order.

Part H – Spot the Mistake

24. A student writes: “The largest DNA fragments travel the farthest through the gel.” Explain the error and correct it.
25. A student writes: “Restriction enzymes cut DNA at random places.” Explain the error and correct it.

Gel Electrophoresis Worksheet Answer Key

Open each part of the gel electrophoresis worksheet answers to check your work. The printable key is at the end of the PDF.

Part A answers (Q1–6)

1. Restriction enzyme: b (cuts dna at a specific base sequence)
2. DNA ligase: e (joins pieces of dna together)
3. Plasmid: c (a small circle of dna found in bacteria)
4. PCR: f (a method that makes millions of copies of a dna segment)
5. DNA ladder: a (dna fragments of known sizes run beside samples to measure them)
6. Recombinant DNA: d (dna made by joining pieces from two different sources)

Part B answers (Q7–10)

7. DNA is negatively charged (phosphate groups), so it is attracted to the positive electrode.
8. The smallest fragments; they slip through the pores of the gel more easily.
9. It contains fragments of known size, so the sizes of sample bands can be estimated.
10. DNA is colourless; the stain binds to it so the bands show up.

Part C answers (Q11–14)

11. 2
12. 3 fragments
13. 5, 18, 10 bp (total 33 bp)
14. The short single-stranded overhangs can pair with matching ends cut by the same enzyme, so DNA from two sources can be joined.

Part D answer (Q15)

15. Benefit: e.g. higher yields, less pesticide spraying, better nutrition. Concern: e.g. genes spreading to wild plants, pests evolving resistance, effects on non-target insects, corporate control of seeds.

Part E answers (Q16–18)

16. Suspect 2
17. Every band lines up with the crime scene bands: same number and same positions.
18. About 3000 bp

Part F answers (Q19–20)

19. Man B
20. The child's 6000 bp band matches the mother, so the 1500 bp band must come from the father. Man B has it; Man A does not, so he is excluded.

Part G answers (Q21–23)

21. 10 × 2⁵ = 320 molecules
22. 2³⁰ = 1 073 741 824 ≈ 1.07 × 10⁹ copies
23. Q → S → T → P → R

Part H answers (Q24–25)

24. The smallest fragments travel farthest; large fragments are slowed down by the gel and stay near the wells.
25. Each restriction enzyme cuts only at its own specific recognition sequence (EcoRI cuts G^AATTC).

5 Common Mistakes on a Gel Electrophoresis Worksheet

1. Thinking big fragments travel farther. Small fragments move farthest.
2. Forgetting the ladder. Always estimate sizes by comparing to the ladder lane.
3. Matching only some bands. A DNA fingerprint match needs every band to line up.
4. Assuming restriction enzymes cut randomly. Each cuts only at its own recognition sequence.
5. Counting fragments wrong. On a straight piece of DNA, n cuts make n + 1 fragments.

How to Use This Gel Electrophoresis Worksheet in Class

• Lesson 1: Parts A–D of the gel electrophoresis worksheet. Cut a paper "DNA strip" at every GAATTC to model EcoRI.
• Lesson 2: Parts E–H, ideally alongside a dye electrophoresis lab or an online virtual gel simulation.

Review with the biotechnology quiz.

Frequently Asked Questions

Is this gel electrophoresis worksheet free?

Yes. The worksheet and its answer key are free to download and print as a PDF, with no account needed.

Why do smaller DNA fragments travel farther in a gel?

The gel is a mesh of tiny pores. Small fragments slip through the pores easily, while large fragments get slowed down, so after the same time the small ones have moved farther from the wells.

Why does DNA move toward the positive electrode?

The phosphate groups in DNA's backbone carry a negative charge, so DNA is attracted to the positive end of the gel.

How do you read a DNA fingerprinting gel?

Compare the band patterns lane by lane. A suspect matches the crime scene sample only if every band lines up in the same positions.

How does a paternity test gel work?

Every band in a child's DNA must come from either the mother or the father. Bands that don't match the mother must appear in the biological father's lane.

More Free Grade 11 Biology Resources

• DNA Replication WorksheetStructure and copying of DNA
• Protein Synthesis WorksheetFrom gene to protein
• Punnett Square WorksheetInheritance patterns
• Biotechnology QuizMultiple-choice review
• All Grade 11 ResourcesWorksheets and quizzes

Ready to start? Download the free gel electrophoresis worksheet PDF (use the Download button above), print it double-sided and keep the key for marking.